Bookmark


  • Page views
  • PDF Downloads


ISSN: 2766-2276
2025 September 30;6(9):1367-1379. doi: 10.37871/jbres2192.
    Subject area(s):

 |   |   | 


open access journal Research Article

Molecular Detection of Borrelia burgdorferi sensu lato, Babesia odocoilei, Babesia microti and Anaplasma phagocytophilum in Ixodes Ticks in British Columbia, Canada

John D Scott* and Catherine M Scott

Upper Grand Tick Research Centre, 365 St. David Street South, Fergus, Ontario, Canada N1M 2L7
*Corresponding authors: John D Scott, Upper Grand Tick Research Centre, 365 St. David Street South, Fergus, Ontario, Canada N1M 2L7 E-mail:

Received: 22 September 2025 | Accepted: 27 September 2025 | Published: 30 September 2025
How to cite this article: Scot JD, Scott CM. Molecular Detection of Borrelia burgdorferi sensu lato, Babesia odocoilei, Babesia microti and Anaplasma phagocytophilum in Ixodes Ticks in British Columbia, Canada. J Biomed Res Environ Sci. 2025 Sept 30; 6(9): 1367-1379. doi: 10.37871/jbres2192, Article ID: jbres1757
Copyright:© 2025 Scott JD, Scott CM. Distributed under Creative Commons CC-BY 4.0.
Keywords
  • Lyme disease
  • Borrelia burgdorferi sensu lato
  • Human babesiosis
  • Babesia odocoilei
  • Ixodes pacificus
  • Ixodes scapularis
  • Ixodes spinipalpis
  • Established populations
  • Nidicolous tick
  • Songbirds

In total, 76 Ixodes ticks were collected in southwestern British Columbia (BC). Five Ixodes species (I. angustus, I. cookei, I. pacificus, I. scapularis, and I. spinipalpis), which bite humans, were collected and tested. Two Ixodes spp. (I. rugosus, I. sculptus), which do not bite humans, were collected and tested. Using real-time and nested PCR, the four pathogens were detected, namely Borrelia burgdorferi sensu lato (19/76, 25%), Babesia odocoilei (12/76, 16%), Babesia microti (1/76, 1%), and Anaplasma phagocytophylum (2/76, 3%). We provide the first report of Ixodes scapularis parasitizing an eastern cottontail, Sylvilagus floridanus, in Canada. We document the first molecular identification of Ixodes sculptus parasitizing an American mink, Neogale vision; this tick-host parasitism occurred on Vancouver Island, BC. At an established population on mainland BC, Ixodes pacificus adults (7/15, 47%) were positive for Babesia odocoilei. We report the first Ixodes pacificus parasitizing a Mallard Duck, Anas platyrhynchos. Based on the findings of this tick-host-pathogen study, healthcare practitioners must be aware that at least 5 different Ixodes spp. transmit tick-borne zoonotic pathogens in BC. Babesia odocoilei does not respond to doxycycline treatment.

Tick-borne zoonotic diseases cause horrific disability worldwide. Once they become chronic, tick-borne diseases are persistent, and recalcitrant to treat. In North America, Ixodes ticks can carries more than one pathogen [1]. In fact, four pathogens have been detected in an Ixodes scapularis adult [2]. Ixodes scapularis has previously been detected in British Columbia (BC) [3]. Another Ixodes tick in western Canada is Ixodes spinipalpis which is found in parts of Alberta and BC [4]. This nidicolous tick spends much of its time in a darken cavity nestled within a burrow. Researchers have found that Ixodes spinipalpis bites humans, and can transmit the Lyme disease bacterium, Borrelia burgdorferi sensu lato (hereafter Bbsl) [5-10]. Bbsl was first discovered in Ixodes scapularis ticks collected on Long Island, NY [11]. Around the globe, there are at least 24 valid genospecies of Bbsl.

Acarologists have found that Babesia odocoilei (Apicomplexa: Piroplasmidae: Babesiidae), a single-celled, red blood cell parasite is equally as prevalent as Bbsl across Canada [12]. Also, these researchers discovered that the ratio of Babesia odocoilei to Babesia microti in Ixodes scapularis adults was 60 to 1 nation-wide [12]. Markedly, Babesia odocoilei was first discovered in patients in Ontario, Canada [13,14]. The black-tailed deer, Odocoilei hemionus columbianus, are prominent cervids in southwestern BC, and are reservoirs of Babesia odocoilei [15]. In addition, this intracellular piroplasmid has been documented in the U.K. [16] and in the E.U. [17]. This piroplasmid is normally transmitted by a tick bite [18], but may be transmitted by blood transfusion [19], organ transplantation [20], and maternal-fetal transmission [21-24]. Whenever a pregnant person has been bitten by a tick, obstetricians must include neonatal Babesia in the differential diagnosis when screening for neonatal sepsis [22].

Ixodes cookei, the groundhog tick, is common in eastern Canada [4], but was previously found in BC [25]. This tick species does not parasitize birds [4].

Ixodes augustus was documented in Ixodes ticks in BC [12,25]. As well, this ixodid tick does not parasitize birds [4].

The primary objective of this study was to screen ticks for Bbsl, Babesia odocoilei, Babesia microti, Bartonella spp., and Anaplasma phagocytophilum, and embark on finding the prevalence of these tick-borne zoonotic pathogens in southwestern BC.

Tick collection

Veterinarians, veterinary technicians, veterinary associates, wildlife rehabilitators, and the public collected ticks from domestic and wildlife mammals. Flagging low-level vegetation complimented collection. At the beginning of the study, 2 mL micro tubes, each containing 95% ethyl alcohol, were sent to veterinary participants. Vials for live ticks were sent to wildlife rehabilitators. At the end of the collection period, ticks were returned to the laboratory (J.D.S.) for identification using taxonomic tick keys [4,26-28]. Three Ixodes ticks were taken to the Centre for Biodiversity Genomics, University of Guelph for molecular identification.

We document the first account of Ixodes spinipalpis (nidicolous tick) molting from nymphs to adults (transstadial passage). Fully engorged Ixodes spinipalpis nymphs were held in darkness to molt to adults. The temperature was set at 20-25°C, and the humidity at 80-95%. Technical assistance was obtained from a scientist in Belgium―see Acknowledgments.

Molecular analysis

DNA extractions and PCRs were completed by Geneticks Inc. Ticks were bisected lengthwise. Each half was homogenized by beating a 400 μl DNA/RNA shield (ZymoResearch) with a mix of 2.3 mm and 0.1 mm Zirconia/Silica beads (BioSpec Products). Samples were subjected to two subsequent runs for 5 min at 2400 RPM in a Mini-Beadbeater-96 (BioSpec Products). Total nucleic acid was isolated from homogenized tick halves using the Quick-DNA/RNA Pathogen Miniprep (Zymo Research) following the manufacturer’s instructions.

    A combination of real-time PCR and nested PCR assays were used for pathogen detection. The primers and probes used in this study are listed in Table 1 below. All samples were tested for the presence of Borrelia spp., Borrelia miyamotoi, Anaplasma phagocytophilum, Babesia microti, Babesia odocoilei, and Bartonella spp. All Borrelia testing was performed using real-time PCR in 30 µl reaction volumes using 15 µl of PC RBIO Probe Blue Mix (PCRBiosystems). Subsequently, 800 nM of both forward and reverse primers, 250 nM of probe, and 10 µl of extracted total nucleic was used as the template. Reactions were subjected to an initial denaturation of 8 min at 95°C followed by 40 cycles at 95C for 10 sec, and 60°C for 30 sec. Real-time PCR reactions were performed using a Stratagene Mx3005P qPCR machine (Agilent Technologies). To interpret qPCR results, the following algorithm was used: samples that tested positive for both Borrelia spp., B. miyamotoi were considered positive for B. miyamotoi. Samples testing positive for Borrelia spp., but negative for B. miyamotoi, were considered positive for Bbsl. Samples that tested negative for both Borrelia spp. and B. miyamotoi were considered negative for all Borrelia spp.

Table 1. Primers and probe used for pathogen detection.
Genus/Species Gene PCR Type Primer Name Sequence (5’-3’) Amplicon Size Reference
Borrelia spp. 23s IGS qPCR Bb23Sf cgagtcttaaaagggcgatttagt 75 [29]
Bb23Sr gcttcagcctggccataaatag
Bb23SProbe FAM-agatgtggtagacccgaagccgagtg-ECLIPSE
Borrelia miyamotol flaB qPCR flaBf ccttcaagtactccagatccattg 102 [30]
flaBr aacaaagacggcaagtacgatc
flabprobe FAM-TGCAACAGTAGACAAGCTTGAGCT-ECLIPSE
Anaplasma phagocytophilum msp2 Nested PCR AnaP44OutL1-F GTAGAAGAAACCGCCCTAAT 850 [31]
AnaP44OutL1-R TCTATGTTGGTTTGGATTACAG
MSP3F CCAGCGTTTAGCAAGATAAGAG 334 [32]
MSP3R GCCCAGTAACAACATCATAAGC
Babesia microti 18s rRNA Nested PCR Bab1 CTTAGTATAAGCTTTATACAGC 238 [33]
Bab4 ATAGGTCAGAAACTTGAATGATACA
Bab2 GTTATAGTTTATTTGATGTTC 155
Bab3 AAGCCATGCGATTCGCTAAT
Babesia odocoitel 18s rRNA Nested PCR Bab306R_RCF TTTCTGCGTCACCGTATT 331 [34]
BabGeninR2 ACGACGGTATCTGATCGTCT 311
odo563 CCGTATTTGACTTTGTCGACTGT 311 [31]
BabGeninR1 TCTGATCGTCTTCGATCCC
Bartonella spp. RibC Nested PCR RibC-1F CGGATATCGGTTGTGTTGAA 309 [35]
RibC-1R CATCAATRTGACCAGAAACCA
RibC-2F GCATCAATTGCTTGTTCA 182
RibC-2R CCCATTTCATCACCCAAT

Detection of A. phagocytophilum, B. microti, B. odocoilei, and Bartonella spp. was performed by nested PCR in 25 µl reaction volumes using 12.5 µl of 2x Taq FroggaMix (Frogga Bio Scientific Solutions). Next, 400 nM of both forward and revere primers, and 2 µl of template. The outer reaction conditions for A. phagocytophilum included an initial denaturation of 95°C for 10 min followed by 35 cycles of 95°C for 30 sec, 53°C for 30 sec, 72°C for 1 min, and a single final extension of 72°C for 10 min. The inner reaction conditions were identical, except annealing which was performed at 55°C, and 40 total reaction cycles were used. The outer reaction conditions for Babesia odocoilei included an initial denaturation at 95°C for 10 min, followed by 40 cycles of 95°C for 30 sec, then 58°C for 30 sec, 72°C for 30 sec, and a single final extension of 72°C for 10 min. The inner reaction state was identical, except annealing was performed at 63°C for 15 sec, and extension was performed at 72°C for 20 sec. Both outer and inner reaction conditions for Babesia microti included an initial denaturation at 95°C for 10 min, followed by 35 cycles of 95°C for 30 sec, 55°C for 30 sec, 72°C for 30 sec, and a single final extension of 72°C for 10 min. For Bartonella spp., the outer reaction included an initial denaturation at 95°C for 10 min, followed by 40 cycles at 95°C for 30 sec, 57°C for 30 sec, 72°C for 60 sec, and a single final extension of 72°C for 10 min. The inner reaction was identical, except the annealing temperature was 52°C, and the extension time was reduced to 30 sec. All nested PCR reactions were performed in a MJ Research PTC-225 Tetrad Thermocycler (BioRad).

Overall, twelve established populations of Ixodes ticks (i.e., I. pacificus, n = 8; I. scapularis, n = 2; and I. spinipalpis, n = 2) were detected within the following regions: Metro Vancouver, Fraser Valley, Okanagan Valley, Sea to Sky Corridor, Whistler Valley, Greater Victoria, Cowichan Valley, and Sunshine Coast. Other Ixodes ticks collected included I. angustus, I. cookei, I. rugosus, I. sculptus, and I. texanus. The I. sculptus was collected from an American mink, Neogale vision, on 10 March 2025 at Saanich, BC. This parasitism is the first report of an I. sculptus on Vancouver Island, BC.

    Eight I. spinipalpis ticks were collected from an eastern cottontail on 10 April 2025 at Victoria, BC. Five of 8 (63%) I. spinipalpis were positive for Bbsl. One of these gravid females laid viable eggs that hatched to active larvae (Figure 1).

We collected an Ixodes rugosus female from a striped skunk, Mephitis mephitis, on 31 March 2025 at West Vancouver, and this female was positive for Babesia microti. This tick-host-pathogen record is a first.

We collected an Ixodes spinipalpis male from an eastern cottontail at Sidney, BC on 15 May 2025; this male was positive for Anaplasma phagocytophilum―a tick-host-pathogen first.

Two I. scapularis females were collected from an eastern cottontail on 20 May 2025 at North Saanich, BC. This tick-host finding confirms that this tick species is indigenous in BC.

We flagged a site in the Hope area (Fraser Valley), and 7 of 15 (47%) of Ixodes pacificus adults were positive for Babesia odocoilei. This is the premiere documentation of B. odocoilei in an establish population in Canada. Paradoxically, all Ixodes pacificus collected and tested from this site were void of Bbsl.

An I. scapularis female collected on 26 May 2025 from a dog in the Whistler Valley was infected with Babesia odocoilei. Likewise, a partially engorged I. pacificus female was collected on 10 March 2025 at Duncan, BC, and was positive for Babesia odocoilei.

A slightly engorged I. pacificus female was collected from a dog residing at Squamish, BC (Sea to Sky Corridor), and it was positive for Babesia odocoilei.

Two I. pacificus nymphs were collected from a Mallard Duck on 13 May 2025 at Victoria, BC. These engorged fully engorged nymphs molted to females in 40 d and 41 d. We provide the first documentation of Ixodes pacificus parasitizing a Mallard Duck.    

Three ticks were sent to the Centre for Biodiversity Genomics for molecular identification, and included: Ixodes cookei, 24-5A107; Ixodes sculptus, 25-5A6; and Ixodes spinipalpis, 24-5A106B1.

We did not find Bartonella spp. in any of the ticks tested during the present study.

One of the unique features of I. spinipalpis females is retrograde auriculae; quite often they are broken off during tick removal. We molted fully engorged nymphs to adults to confirm their morphological identification. The presence of retrograde auriculae in females is a distinguishing physical characteristic of I. spinipalpis.

Four pools of viable ticks (10/pool) were tested for transovarial transmission; all were negative.

Ixodes ticks (i.e., I. pacificus, I. scapularis) infesting cats and dogs were positive in various locations for Bbsl and Babesia odocoilei. For example, Ixodes pacificus were positive for Babesia odocoilei at the following locations: Hope, Sooke, Squamish, Victoria), and Ixodes scapularis were positive for Babesia odocoilei at Whistler (Whistler Valley). Ixodes ticks: Ixodes pacificus and Ixodes scapularis) were positive for Bbsl at Duncan, Nanaimo, North Saanich, Saanich, Victoria, Vancouver, Whistler, and Okanagan.

During this tick-pathogen-host study, we collected five different Ixodes species in southwestern BC that are vectors of the Lyme disease bacterium, Borrelia burgdorferi sensu lato complex. In order to obtain a better understanding of the pathophysiology of sequestering Babesia species, we gleaned pertinent information from the veterinary and Plasmodium falciparum malaria literature. Babesia odocoilei, a single-celled red blood celled parasite, has fibrin-bonding entanglements that occlude capillaries and venules. Since human babesiosis caused by Babesia odocoilei is an energy-draining disease, it has taken the spotlight continent wide. Human babesiosis is a nationally notifiable disease in Canada. However, valid cases are not being reported. The lack of due diligence by Public Health Agency of Canada in reporting cases is counterintuitive. Clinicians must recognize that human babesiosis caused by Babesia odocoilei is serious, and requires a different antibabesial regimen for treatment than Bbsl.

Ticks on acaricide-treated dogs

When Ixodes ticks are removed from dogs, there is every likelihood that the canine has been treated with an acaricide (i.e., fluralaner, lotilaner). Since ticks on these treated dogs are generally dead, testing them for tick-borne zoonotic diseases is worthless. Therefore, the degradation of the DNA in these dead ticks greatly reduces the prevalence of tick-borne zoonotic pathogens. As a result, our prevalence results are reduced, but we were not able to determine the extent of the reduction.

Ixodes scapularis indigenous in BC

We found that Ixodes scapularis is an ectoparasite of eastern cottontails in BC. The collection of Ixodes scapularis females from eastern cottontails confirms that this tick species is established in BC. Ixodes scapularis were previously collected from a Mallard duckling on Vancouver Island, BC [3]. Now, we collected Ixodes scapularis from eastern cottontails, and these lagomorphs had no out-of-province travel. The infestation of Ixodes scapularis on eastern cottontails confirmed that they were locally-acquired and, therefore, are indigenous in BC. Unquestionably, Ixodes scapularis is established in the Pacific Northwest.

Historically, Banerjee SN, et al. [36,37] documented Bbsl in 24 established populations of Ixodes pacificus in southwestern BC. In the present 6-mo study, we documented 12 established populations consisting of three tick species, namely I. pacificus, I. scapularis, and I. spinipalpis.

Birds disperse Ixodes ticks

Birds play a dynamic role in the wide dispersal of certain songbird-transported, Ixodes ticks in BC. They include raptors (Order: Falconiformes) [38], gallinaceous birds (Order: Galliformes) [39], dabbling ducks (Order: Anseriformes) [3], and passerines (Order: Passeriformes) [40] (Figure 2). Whenever fully engorged larvae and nymphs drop from these avian hosts, they must go through a molt (transstadial passage) for 5 to 8 wk before they are ready to take the next blood meal from the next suitable host, including a pet or a human. Markedly, scientists have detected pathogens (i.e., Bbsl, Babesia odocoilei, Anaplasma phagocytophilum) in the brachial blood of songbirds during the nesting period [41]. Notably, Ixodes scapularis larvae and nymphs can transmit tick-borne zoonotic pathogens, such as Bbsl [11] and Babesia odocoilei [13,14] during a blood meal. Whenever, anyone frequents a wooded area in temperate weather, they heighten their risk of being bitten, and becoming infected with a tick-borne zoonotic pathogen. Such co-infections make diagnosis and treatment more complex because they require entirely different antimicrobials. Notably, passerine migrants play an inherent function in the wide dispersal of songbird-transport ticks across the Canadian landscape [12,25,42-49]. Comorbidity confounds treatment, especially when a sequestering Babesia is concerned.

Discovery of established populations of Ixodes species

Three species of Ixodes ticks (i.e., I. pacificus, I. scapularis, I. spinipalpis) formed established populations. These populations were found on both Vancouver Island and the mainland. The standard criteria (6 of one life stage, or then, 2 or more life stages) for an established population that pinpointed 12 locations [50,51]. Depending on the individual population, ticks were collected opportunistically from domestic and wildlife mammals, a Mallard and, also, by flagging in southwestern BC. The term “deer tick” is a misnomer because Ixodes scapularis has at least 150 vertebrate (avian, mammalian, reptilian) hosts [27].

Eastern cottontails are reservoirs of Borrelia burgdorferi sensu lato

Eastern cottontails in southwestern BC were originally from Missouri [52]. Researchers previously detected Bbsl in eastern cottontails in southeastern Missouri [52]. When we collected Ixodes spinipalpis from these lagomorphs, we found the infection prevalence was surprising high suggesting these rabbits are a reservoir of Bbsl. Coyotes, Canis latrans, are a predator of eastern cottontails, and will help to keep the lagomorph population in check.

Sequestering Babesia is recalcitrant

When an Ixodes scapularis tick is infected with Babesia odocoilei, it stores kinetes in its salivary glands. At tick bite, these kinetes are converted to infective sporozoites to adapt to the new host. In the blood stream, sporozoites gradually change to infective trophozoites, and then to infective merozoites [53]. When a Babesia-vector tick (i.e., I. pacificus, I. scapularis) feeds, the kinetes change into infective sporozoites. A new infection, called human babesiosis caused by Babesia odocoilei is revealed [13,14]. Once the infection is established, fibrinogen converts to fibrin, and adheres to the endothelium walls (cytoadherence) [54]. At the same time, fibrin combines with infected red blood cells (iRBCs) and uninfected red blood cells (uRBCs). Fibrin-bonded entanglements occlude capillaries and venules, and these occlusions (iRBCs, uRBCs, fibrin) block the flow of blood (sequestration}, especially in the smallest capillaries in the brain followed closely in diameter as gut capillaries [55]. Many capillaries and venules throughout the body become partially or completely occluded. Sequestering Babesia spp. (i.e., B. canis, B. odocoilei) can complete their life cycle within these fibrin-bonded entanglements and, therefore, remain isolated from the circulating immune system and spleen [56]. In essence, Babesia odocoilei can survive and propagate in these self-sustaining microcosms, in perpetuity. Sequestering Babesia spp. can be extremely recalcitrant to treat, and patients may have a fatal outcome [57,58].

Babesia odocoilei survival strategy

Babesia odocoilei has several attributes to survive in suitable hosts. First, this piroplasmid is pleomorphic (diverse forms) in the human body. These forms include sporozoites, trophozoites, merozoites and gametocytes. Second, this intraerythrocytic piroplasmid forms fibrin-bonded entanglements for sequestration in capillaries and postcapillary venules. Babesia odocoilei sequesters in the brain causing cerebral pathophysiology, namely encephalitis. This babesial piroplasmid constrains the function of mitochondria to produce ATP efficiently and, thus, this zoonosis becomes an energy-zapping disease [59]. When a co-infection of Bbsl and Babesia odocoilei is present, Babesia odocoilei stands in the way of Lyme disease recovery. Of medical importance, doxycycline does not treat Babesia infections [60]. The symptoms of human babesiosis caused by Babesia odocoilei are forthcoming in Table 2.

Table 2.Symptoms of human babesiosis caused by Babesia odocoilei.
Symptoms can include any combination of the following:
Early-onset symptoms
unrelenting fatigue ongoing inflammation cognitive impairment
legs ache/restless legs dysphoric (intense unease) unexplained pain, sore eyes
brain fog/dyslexia decreased blood pressure panic attack, feel scared
delirium/disorientation hallucinations/head pressure abnormal/wild dreams
anxiety/cry easily, moody difficulty remembering dementia, memory loss
dizziness, blurred vision liver ache from toxin/infection muscle aches/joint pain
vascular occlusions numbness, numb hands irritability/rage/aggression
poor balance/clumsiness unsteady gait/difficult walking sore head/pressure in head
bladder dysfunction lethargic bowels/constipation fluctuation of emotions
periods of being in a daze air hunger, shortness of breath sleep disturbances/insomnia
numbness in fingers/face chills/heat and cold intolerance sweats (especially at night)
increased thirst lack of reading comprehension nausea/abdominal pain
nerves on fire/in a daze pathogen-induced depression loss of interest in hobbies 
Late-onset symptoms
Late-onset symptoms typically become chronic at 6 months.
chronic headaches anhedonia (inability to feel joy) dysautonomia nervousness
thyroid-like signs feel sorrow/misery/emotional peripheral neuropathy
enhanced dementia reading comprehension impaired ischemia (slow blood flow)
seizures/coma/stroke white matter hyperintensities suicidal/homicidal ideation
lack of balance/shakes motion sickness/difficulty walking leg weakness/muscle spasm
gruelling fatigue stretches chronic encephalopathy relentless disability intolerance to do physical activity dyslexia (trouble read/write) severe hemolysis

In some cases, patients of human babesiosis caused by Babesia odocoilei have fatal outcomes (Dan Cameron, MD). Since Babesia odocoilei is a sequestering Babesia sp., fibrin-bonded entanglements occlude capillaries and post-capillary venules, and cause unrelenting fatigue and severe disability. This tick-borne zoonosis is recalcitrant to treat [13,14]. In contrast, B. microti is a non-sequestering Babesia species, and has the propensity to be relatively easy to treat. Many people contend that they have dementia, but in reality, they may have a tick-borne zoonotic disease, namely human babesiosis caused by Babesia odocoilei [13,14].

Labeling by clinicians

When healthcare practitioners have no explanation for mental, emotional, and physical dysfunctions, they label febrile patients with familiar morbidities, such as chronic fatigue syndrome, fibromyalgia, psychotic depression, Rasmussen’s syndrome, ADHD, mast-cell activation syndrome, multiple sclerosis, dementia, POTS, Tourette’s syndrome, unexplained autoimmune issues, and more. Quite often these illnesses are a tick-borne zoonotic disease, such as Lyme disease or human babesiosis.

   Anyone with a known or suspected tick bite regularly assumes that the pathogen is the Lyme disease bacterium. However, scientists have found that Ixodes ticks are just as apt to be infected with Babesia odocoilei as Borrelia burgdorferi sensu lato [12]. This default strategy, and subsequent treatment regimen for Lyme disease, fails to work if a sequestering Babesia sp. is present. Of medical importance, doxycycline does not treat Babesia infections [60].   Also, when treatment for Babesia odocoilei is halted, symptoms can recrudesce [13,61]. One inescapable fact remains: sequestering Babesia is hard to treat effectively with standard antibabesials [13,61].

Southwestern BC has at least five Ixodes species that bite humans. We found that Ixodes pacificus, Ixodes scapularis, and Ixodes spinipalpis harbor Babesia odocoilei, and these Ixodes ticks can transmit this pathogen to humans. We also discovered the first established population of Ixodes pacificus positive for Babesia odocoilei. We provide the first report of Ixodes pacificus (nymphs)parasitizing a Mallard Duck. We provide the first account of Ixodes scapularis parasitizing an eastern cottontail in Canada. The presence of several Babesia odocoilei-infected Ixodes spinipalpis parasitizing a single eastern cottontail indicates this host is a reservoir. Based on our collection of Ixodes ticks, namely Ixodes pacificus, Ixodes scapularis, and Ixodes spinipalpis, we exposed 12 established populations in southwestern BC. With the overpopulation of deer, predators (i.e., coyotes) are needed to manage deer numbers and, moreover, the government game management programmes must be channeled to vigorously cull the deer herds to mitigate Babesia odocoilei. Emphatically, clinicians must realize that patients who are bitten by Ixodes ticks are just as likely to be infected with Babesia odocoilei as Borrelia burgdorferi sensu lato. Explicitly, doxycycline does not treat human babesiosis caused by Babesia odocoilei.

Ethical consideration

Ethical approval is not required to remove and collect ticks from avian and mammalian hosts. Regulatory approval is not needed to withhold engorged ticks to molt.

Authors’ contribution

Conceptualization and design: JDS and CMS. Collection and methodology: JDS. Formal analysis: JDS and CMS. Drafting of manuscript: JDS and CMS. Accuracy of data: JDS and CMS. Both authors read and approved the final version of this scientific manuscript.

Competing financial and investment interests

The authors declare that they have no competing financial or investment interests relating to this study.

This biological and molecular research is dedicated in honor of the late Dr. Laverne Kindree and his wife Mrs. Norma Kindree (centenarian in 2025) of Squamish, BC. During the late 1980s and 1990s, Dr. and Mrs. Kindree were forerunners in pioneering tick research and, at the same time, support clinical acumen of tick-borne zoonotic diseases in BC. We are most grateful to their daughter, Ms. Diane Kindree, who has honored her parents by being a philanthropic contributor to this groundbreaking study.

We thank veterinarians, veterinary technicians, wildlife rehabilitators, bird banders, and the public for collecting Ixodes ticks for this study in BC. We are indebted to Alicia Koechl for helping to compile tick data for testing and, also, for conducting computer graphics in the manuscript. We are pleased that Justin Wood, Geneticks Canada could test ticks for tick-borne zoonotic pathogens. For technical assistance to molt nidicolous ticks, we thank Dieter Heylen, Evolutionary Ecology Group, Department of Biology, University of Antwerp, Wilrijk, Belgium. For computer graphics and graphic design, we sincerely thank Glenn Funk. We thank Jayme Sones and Sean Prosser, Centre for Biodiversity Genomics for administering barcode genomics.

  1. Stricker RB, Fesler MC. Chronic Lyme disease: A working case definition. Am J Infect Dis. 2018;14:1.44.
  2. Sanchez-Vicente S, Tagliafierro T, Coleman JL, Benach JL, Tokarz R. Polymicrobial Nature of Tick-Borne Diseases. mBio. 2019 Sep 10;10(5):e02055-19. doi: 10.1128/mBio.02055-19. PMID: 31506314; PMCID: PMC6737246.
  3. Scott JD, Scott CM. Primary detection of the establishment of blacklegged ticks, Ixodes scapularis, in British Columbia, Canada. J Biomed Res Environ Sci. 2023;4(5):935-941.
  4. Durden LA, Keirans JE. Nymphs of the genus Ixodes (Acari: Ixodidae) of the United States: Taxonomy, identification key, distribution, hosts, and medical/veterinary importance. Monographs; Thomas Say Publications in Entomology, Entomological Society of America: Lanham, MD, USA;1996. p. 95.
  5. Cooley RA, Kohls GM. The genus Ixodes in North America. Natl Inst Health Bull. p. 184.
  6. Gregson JD. The Ixodoidea of Canada. Can Dep Agric., Publ. 930. 1956. p. 92.
  7. Furman DP, Loomis EC. The ticks of California (Acari: Ixodidae). Bull Calif Insect Surv. 1984;25:1-239.
  8. Maupin GO, Gage KL, Piesman J, Montenieri J, Sviat SL, VanderZanden L, Happ CM, Dolan M, Johnson BJ. Discovery of an enzootic cycle of Borrelia burgdorferi in Neotoma mexicana and Ixodes spinipalpis from northern Colorado, an area where Lyme disease is nonendemic. J Infect Dis. 1994 Sep;170(3):636-43. doi: 10.1093/infdis/170.3.636. PMID: 8077722.
  9. Dolan MC, Maupin GO, Panella NA, Golde WT, Piesman J. Vector competence of Ixodes scapularis, I. spinipalpis, and Dermacentor andersoni (Acari:Ixodidae) in transmitting Borrelia burgdorferi, the etiologic agent of Lyme disease. J Med Entomol. 1997 Mar;34(2):128-35. doi: 10.1093/jmedent/34.2.128. PMID: 9103755.
  10. Zeidner NS, Burkot TR, Massung R, Nicholson WL, Dolan MC, Rutherford JS, Biggerstaff BJ, Maupin GO. Transmission of the agent of human granulocytic ehrlichiosis by Ixodes spinipalpis ticks: evidence of an enzootic cycle of dual infection with Borrelia burgdorferi in Northern Colorado. J Infect Dis. 2000 Aug;182(2):616-9. doi: 10.1086/315715. Epub 2000 Jul 28. PMID: 10915099.
  11. Burgdorfer W, Barbour AG, Hayes SF, Benach JL, Grunwaldt E, Davis JP. Lyme disease—a tick-borne spirochetosis? Science. 1982 Jun 18;216(4552):1317-9. doi: 10.1126/science.7043737. PMID: 7043737.
  12. Scott JD, Scott CM. Molecular detection of Borrelia burgdorferi sensu lato, Borrelia miyamotoi, Babesia odocoilei, Babesia microti and Anaplasma phagocytophilum in Ixodes ticks collected across Canada. J Biomed Res Environ Sci. 2024;5(10):1321-1337.
  13. Scott JD, Sajid MS, Pascoe EL, Foley JE. Detection of Babesia odocoilei in humans with babesiosis symptoms. Diagnostics (Basel). 2021 May 25;11(6):947. doi: 10.3390/diagnostics11060947. PMID: 34070625; PMCID: PMC8228967.
  14. Scott JD. Human babesiosis caused by Babesia odocoilei: A confirmed zoonosis. Am J Inf Dis. 2024;20:50-51.
  15. Goff WL, Jessup DA, Waldrup KA, Thomford JW, Conrad PA, Boyce WM, Gorham JR, Wagner GG. The isolation and partial characterization of a Babesia sp. from desert bighorn sheep (Ovis canadensis nelsoni). J Eukaryot Microbiol. 1993 May-Jun;40(3):237-43. doi: 10.1111/j.1550-7408.1993.tb04909.x. PMID: 8508161.
  16. Gray A, Capewell P, Zadoks R, Taggart MA, French AS, Katzer F, Shiels BR, Weir W. Wild deer in the United Kingdom are a potential reservoir for the livestock parasite Babesia divergens. Curr Res Parasitol Vector Borne Dis. 2021 Mar 17;1:100019. doi: 10.1016/j.crpvbd.2021.100019. PMID: 35284871; PMCID: PMC8906096.
  17. Dreghiciu IC, Hoffman D, Dumitru S, Oprescu I, Imre M, Florea T, Plesko A, Iorgoni V, Morariu S, Dărăbuș G, Ilie MS. First molecular identification of zoonotic Babesia odocoilei in ticks from Romania. Microorganisms. 2025 May 22;13(6):1182. doi: 10.3390/microorganisms13061182. PMID: 40572070; PMCID: PMC12195308.
  18. Waldrup KA, Kocan AA, Barker RW, Wagner GG. Transmission of Babesia odocoilei in white-tailed deer (Odocoileus virginianus) by Ixodes scapularis (Acari: Ixodidae). J Wildl Dis. 1990 Jul;26(3):390-1. doi: 10.7589/0090-3558-26.3.390. PMID: 2388362.
  19. Brennan MB, Herwaldt BL, Kazmierczak JJ, Weiss JW, Klein CL, Leith CP, He R, Oberley MJ, Tonnetti L, Wilkins PP, Gauthier GM. Transmission of Babesia microti parasites by solid organ transplantation. Emerg Infect Dis. 2016 Nov;22(11):1869–76. doi: 10.3201/eid2211.151028. PMID: 27767010; PMCID: PMC5088010.
  20. Aladeen J, Wadhawan P, Pendyala R, Bajwa B, Bajwa RP. Transfusion related babesiosis in a non-endemic region (Western New York). Oxf Med Case Reports. 2024 Nov 20;2024(11):omae133. doi: 10.1093/omcr/omae133. PMID: 39575087; PMCID: PMC11576543.
  21. New DL, Quinn JB, Qureshi MZ, Sigler SJ. Vertically transmitted babesiosis. J Pediatr. 1997 Jul;131(1 Pt 1):163-4. doi: 10.1016/s0022-3476(97)70143-4. PMID: 9255211.
  22. Fox LM, Wingerter S, Ahmed A, Arnold A, Chou J, Rhein L, Levy O. Neonatal babesiosis: case report and review of the literature. Pediatr Infect Dis J. 2006 Feb;25(2):169-73. doi: 10.1097/01.inf.0000195438.09628.b0. PMID: 16462298.
  23. Cornett JK, Malhotra A, Hart D. Vertical transmission of babesiosis from a pregnant, splenectomized mother to her neonate. Infect Dis Clin Pract. 2012;20:408-410.
  24. Iyer S, Goodman K. Congenital babesiosis from maternal exposure: a case report. J Emerg Med. 2019 Apr;56(4):e39-e41. doi: 10.1016/j.jemermed.2018.12.044. Epub 2019 Jan 29. PMID: 30709608.
  25. Scott JD, Clark KL, Foley JE, Anderson JF, Bierman BC, Durden LA. Extensive distribution of the Lyme disease bacterium, Borrelia burgdorferi sensu lato, in multiple tick species parasitizing avian and mammalian hosts across Canada. Healthcare (Basel). 2018 Nov 12;6(4):131. doi: 10.3390/healthcare6040131. PMID: 30424543; PMCID: PMC6315338.
  26. Clifford CM, Anastos G, Elbl A. The larval ixodid ticks of the eastern United States (Acarina-Ixodidae). Miscellaneous Publication: Entomological Society of America. 1961;2(3):213-237.
  27. Keirans JE, Hutcheson HJ, Durden LA, Klompen JS. Ixodes (Ixodes) scapularis (Acari:Ixodidae): redescription of all active stages, distribution, hosts, geographical variation, and medical and veterinary importance. J Med Entomol. 1996 May;33(3):297-318. doi: 10.1093/jmedent/33.3.297. PMID: 8667375.
  28. Keirans JE, Clifford CM. The genus Ixodes in the United States: a scanning electron microscope study and key to the adults. J Med Entomol Suppl. 1978 Jul 20;2:1-149. doi: 10.1093/jmedent/15.suppl2.1. PMID: 401322.
  29. Courtney JW, Kostelnik LM, Zeidner NS, Massung RF. Multiplex real-time PCR for detection of Anaplasma phagocytophilum and Borrelia burgdorferi. J Clin Microbiol. 2004 Jul;42(7):3164-8. doi: 10.1128/JCM.42.7.3164-3168.2004. PMID: 15243077; PMCID: PMC446246.
  30. Tokarz R, Tagliafierro T, Cucura DM, Rochlin I, Sameroff S, Lipkin WI. Detection of Anaplasma phagocytophilum, Babesia microti, Borrelia burgdorferi, Borrelia miyamotoi, and Powassan virus in ticks by a multiplex real-time reverse transcription-PCR assay. mSphere. 2017 Apr 19;2(2):e00151-17. doi: 10.1128/mSphere.00151-17. PMID: 28435891; PMCID: PMC5397568.
  31. Crandall KE, Kerr JT, Millien V. Emerging Tick-Borne Pathogens in Central Canada: Recent Detections of Babesia odocoilei and Rickettsia rickettsii. Vector Borne Zoonotic Dis. 2022 Nov;22(11):535-544. doi: 10.1089/vbz.2022.0036. Epub 2022 Oct 19. PMID: 36264197.
  32. Holden K, Boothby JT, Anand S, Massung RF. Detection of Borrelia burgdorferi, Ehrlichia chaffeensis, and Anaplasma phagocytophilum in ticks (Acari: Ixodidae) from a coastal region of California. J Med Entomol. 2003 Jul;40(4):534-9. doi: 10.1603/0022-2585-40.4.534. PMID: 14680123.
  33. Persing DH, Mathiesen D, Marshall WF, Telford SR, Spielman A, Thomford JW, Conrad PA. Detection of Babesia microti by polymerase chain reaction. J Clin Microbiol. 1992 Aug;30(8):2097-103. doi: 10.1128/jcm.30.8.2097-2103.1992. PMID: 1500517; PMCID: PMC265450.
  34. Burgess HJ, Lockerbie BP, Ayalew LE, Dibernardo A, Hrazdilová K, Modry D, Bollinger TK. Species-specific PCR assay for the detection of Babesia odocoilei. J Vet Diagn Invest. 2021 Nov;33(6):1188-1192. doi: 10.1177/10406387211032927. Epub 2021 Sep 22. PMID: 34550025; PMCID: PMC8546463.
  35. Rajakaruna RS, Capps-Ludwig D, Durden LA, Eremeeva ME. Detection of Rickettsia and Bartonella in fleas and ticks collected from pets at veterinary clinics in Georgia, United States. J Parasitol. 2025 Mar 1;111(2):113-122. doi: 10.1645/24-109. PMID: 40090362.
  36. Banerjee SN, Banerjee M, Smith JA, Fernando M. Lyme disease in British Columbia. VII Lyme Disease Foundation International Scientific Conference. Stamford, Connecticut. 1994. p. 88.
  37. Banerjee SN, Banerjee M, Smith JA, Fernando M. Lyme Disease in British Columbia―An Update. BC Med J. 1994;36:540-541.
  38. Scott JD, Anderson JF, Durden LA. First detection of Lyme disease spirochete Borrelia burgdorferi in ticks collected from a raptor in Canada. J Vet Sci Med Diagn. 2013;2:4.
  39. Scott JD, Anderson JF, Durden LA, Smith ML, Manord JM, Clark KL. Ticks parasitizing gallinaceous birds in Canada and first record of Borrelia burgdorferi-infected Ixodes pacificus (Acari: Ixodidae) from California Quail. Syst Appl Acar. 2016;21:1-12.
  40. Scott JD, Anderson JF, Durden LA. Widespread dispersal of Borrelia burgdorferi-infected ticks collected from songbirds across Canada. J Parasitol. 2012 Feb;98(1):49-59. doi: 10.1645/GE-2874.1. Epub 2011 Aug 24. PMID: 21864130.
  41. Scott JD, McGoey E, Morales A, Pesapane RR. Molecular Detection of Anaplasma phagocytophilum, Babesia odocoilei, Babesia species and Borrelia burgdorferi sensu lato in songbirds. J Biomed Res Environ Sci. 2022;3:1451-1459.
  42. Scott JD, Durden LA, Anderson JF. Infection prevalence of Borrelia burgdorferi in ticks collected from songbirds in far-western Canada. Open J An Sci. 2015;5:232-242.
  43. Scott JD, Clark KL, Durden LA. Presence of Babesia odocoilei and Borrelia burgdorferi sensu stricto in a tick and dual parasitism of Amblyomma inornatum and Ixodes scapularis on a bird in Canada. Healthcare (Basel). 2019 Mar 20;7(1):46. doi: 10.3390/healthcare7010046. PMID: 30897803; PMCID: PMC6473902.
  44. Scott JD, Clark KL, Coble NM, Ballantyne TR. Detection and transstadial passage of Babesia species and Borrelia burgdorferi sensu lato in ticks collected from avian and mammalian hosts in Canada. Healthcare (Basel). 2019 Dec 2;7(4):155. doi: 10.3390/healthcare7040155. PMID: 31810270; PMCID: PMC6955799.
  45. Scott JD, Pascoe EL, Sajid MS, Foley JE. Detection of Babesia odocoilei in Ixodes scapularis ticks collected from songbirds in Ontario and Quebec, Canada. Pathogens. 2020 Sep 24;9(10):781. doi: 10.3390/pathogens9100781. PMID: 32987727; PMCID: PMC7598643.
  46. Scott JD, Pascoe EL, Sajid MS, Foley JE. Detection of Babesia odocoilei in Ixodes scapularis ticks collected in southern Ontario, Canada. Pathogens. 2021 Mar 10;10(3):327. doi: 10.3390/pathogens10030327. PMID: 33802071; PMCID: PMC7999371.
  47. Scott JD, Pesapane RR. Detection of Anaplasma phagocytophilum, Babesia odocoilei, Babesia sp., Borrelia burgdorferi sensu lato, and Hepatozoon canis in Ixodes scapularis ticks collected in eastern Canada. Pathogens. 2021 Oct 1;10(10):1265. doi: 10.3390/pathogens10101265. PMID: 34684214; PMCID: PMC8541619.
  48. Scott JD, Clark KL, Foley JE, Bierman BC, Durden LA. Far-reaching dispersal of Borrelia burgdorferi sensu lato-infected blacklegged ticks by migratory songbirds in Canada. Healthcare (Basel). 2018 Jul 25;6(3):89. doi: 10.3390/healthcare6030089. PMID: 30044388; PMCID: PMC6164468.
  49. Scott JD, Fernando K, Banerjee SN, Durden LA, Byrne SK, Banerjee M, Mann RB, Morshed MG. Birds disperse ixodid (Acari: Ixodidae) and Borrelia burgdorferi-infected ticks in Canada. J Med Entomol. 2001 Jul;38(4):493-500. doi: 10.1603/0022-2585-38.4.493. PMID: 11476328.
  50. Eisen RJ, Eisen L, Beard CB. County-scale distribution of Ixodes scapularis and Ixodes pacificus (Acari: Ixodidae) in the continental United States. J Med Entomol. 2016 Mar;53(2):349-86. doi: 10.1093/jme/tjv237. PMID: 26783367; PMCID: PMC4844559.
  51. Scott JD, Foley JE, Clark KL, Anderson JF, Durden LA, Manord JM, Smith ML. Established population of blacklegged ticks with high infection prevalence for the Lyme disease bacterium, Borrelia burgdorferi sensu lato, on Corkscrew Island, Kenora District, Ontario. Int J Med Sci. 2016 Oct 27;13(11):881-891. doi: 10.7150/ijms.16922. PMID: 27877080; PMCID: PMC5118759.
  52. Kollars TM Jr, Oliver JH Jr, Kollars PG, Durden LA. Seasonal activity and host associations of Ixodes scapularis (Acari: Ixodidae) in southeastern Missouri. J Med Entomol. 1999 Nov;36(6):720-6. doi: 10.1093/jmedent/36.6.720. PMID: 10593072.
  53. Jalovecka M, Sojka D, Ascencio M, Schnittger L. Babesia life cycle - when phylogeny meets biology. Trends Parasitol. 2019 May;35(5):356-368. doi: 10.1016/j.pt.2019.01.007. Epub 2019 Feb 4. PMID: 30733093.
  54. Newbold C, Craig A, Kyes S, Rowe A, Fernandez-Reyes D, Fagan T. Cytoadherence, pathogenesis and the infected red cell surface in Plasmodium falciparum. Int J Parasitol. 1999 Jun;29(6):927-37. doi: 10.1016/s0020-7519(99)00049-1. PMID: 10480730.
  55. Schetters T. Mechanisms involved in the persistence of Babesia canis infection in dogs. Pathogens. 2019 Jun 29;8(3):94. doi: 10.3390/pathogens8030094. PMID: 31261942; PMCID: PMC6789894.
  56. Allred DR, Al-Khedery B. Antigenic variation and cytoadhesion in Babesia bovis and Plasmodium falciparum: different logics achieve the same goal. Mol Biochem Parasitol. 2004 Mar;134(1):27-35. doi: 10.1016/j.molbiopara.2003.09.012. PMID: 14747140.
  57. Cameron D. Babesia symptoms can be deadly: a family’s story. 2021.
  58. Breitschwerdt EB, Maggi RG, Robveille C, Kingston E. Bartonella henselae, Babesia odocoilei and Babesia divergens-like MO-1 infection in the brain of a child with seizures, mycotoxin exposure and suspected Rasmussen's encephalitis. J Cent Nerv Syst Dis. 2025 Mar 12;17:11795735251322456. doi: 10.1177/11795735251322456. PMID: 40083671; PMCID: PMC11905044.
  59. Yang X, Wang N, Ren S, Hu Y, Wang H, Ji A, Cao L, Li M, Liu J, Wang H. Phosphorylation regulation of cardiac proteins in Babesia microti-infected mice in an effort to restore heart function. Parasit Vectors. 2022 Mar 21;15(1):98. doi: 10.1186/s13071-022-05233-7. PMID: 35313969; PMCID: PMC8935697.
  60. Cameron D. Why single-dose doxycycline after a tick bite is bad medicine. 2025.
  61. Rawls W. Understanding Babesia. 2017.
Public Health Biology Cancer Pharmacology Virology Cardiovascular Diseases Oncology Microbiology Environmental Impacts Clinical Cardiology Infectious Diseases Environmental Contamination Surgery Neurology Nutrition Epidemiology Educational Science Mental Health Pediatrics Immunology Psychiatry Community Health Pulmonology Material Science Ecosystem Science Therapeutics Orthopedics Neurological Disorders Gynecology Womens Health and Care Pathology Pharmaceutica Analytica Acta Blood Disorders Gastroenterology Artificial Intelligence Biotechnology Hematology Metabolism Climate Change Biology Physics Biochemistry Depression Brain Disorders Diabetes Clinical Trials Dermatology Toxicology Genetics Neonatal Care Vascular Medicine Dentistry Soil Science Nephrology Reproductive Medicine Computer Science Antivirology Metabolic Syndromes Radiation Therapy Molecular Biology Clinical Endocrinology Genomics Natural Resource Management Anxiety Food Science Alternative Medicine Respiratory Medicine Otolaryngology Cellular Biology Ecotoxicology Parasitology Neurosurgery Immunotherapy Musculoskeletal Disorders Rare Disorders Biomedicine Rheumatology Antiretrovirology Bioengineering Physical Therapy Pain and Relief Alzheimers Physiology Vaccines Internal Medicine Biomedical Science Sports Science Urology Nanotechnology Forestry Bioinformatics Veterinary Science Hepatology Nuclear Medicine Atmospheric Chemistry Biological Oceanography Biometrics Hypertension Aquatic Chemistry Rehabilitation Stem Cells Ecohydrology Trauma Sleep Disorders Molecular Biomarkers Biomedical Engineering Ophthalmology Nutritional Disorders Nursing HIV/AIDS Parkinsons Disease Anesthesiology Emergency Medicine Liver Gerontology Bioanalysis Organic Chemistry Mathematics Neurooncology Drug Metabolism Brain Tumors Anatomy Biosphere Interactions Invitro Fertilization Green Chemistry Rhinology Nanomedicine

Content Alerts

SignUp to our
Content alerts.


Creative Commons License This work is licensed under a Creative Commons Attribution 4.0 International License.


✨ Call for Preprints Submissions

Are you the author of a recent Preprint? We invite you to submit your manuscript for peer-reviewed publication in our open access journal.
Benefit from fast review, global visibility, and exclusive APC discounts.

Submit Now   Archive
?