Bookmark


  • Page views 985
  • PDF Downloads 99


ISSN: 2766-2276
Medicine Group . 2023 August 17;4(8):1195-1205. doi: 10.37871/jbres1787.

 |   |   | 


open access journal Research Article

Differential Expression of the MiT/TFE Transcription Factor Family in Vascular Endothelial Cells under Low Oscillatory Shear Stress

Huanhuan Li1,2, Xiangyi Zuo1, Chunkai Wang1, Wanli Yu1, Liwen Deng1, Yu Zhao1 and Xuehu Wang1*

1Department of Vascular Surgery, the First Affiliated Hospital of Chongqing Medical University, Chongqing 400016, China
2Department of Emergency, Chongqing University Three Gorges Hospital, Chongqing 404000, China
*Corresponding author: Xuehu Wang, Department of Vascular Surgery, the First Affiliated Hospital of Chongqing Medical University, Chongqing 400016, China E-mail:
Received: 02 August 2023 | Accepted: 16 August 2023 | Published: 17 August 2023
How to cite this article: Li H, Zuo X, Wang C, Yu W, Deng L, Zhao Y, Wang X. Differential Expression of the MiT/TFE Transcription Factor Family in Vascular Endothelial Cells under Low Oscillatory Shear Stress. 2023 Aug 17; 4(8): 1197-1205. doi: 10.37871/jbres1757, Article ID: jbres1757
Copyright:© 2023 Li H, et al. Distributed under Creative Commons CC-BY 4.0.
Keywords
  • Shear stress
  • Hemodynamics
  • MiT/TFE transcription factor family
  • Vascular endothelial cells
  • Inflammation

Low Oscillating Shear Stress (LOSS) is known to promote inflammation and atherosclerosis, impacting the phenotype and function of Vascular Endothelial Cells (VECs). The microphthalmia/transcription factor E (MiT/TFE) family of transcription factors regulates autophagy and lysosomal biogenesis in response to internal and external stressors. However, whether LOSS affects the expression of MiT/TFE family members in Human Umbilical Vein Endothelial Cells (HUVECs) has remained unclear. In this study, we utilized qPCR and WB to examine how LOSS influenced the mRNA and protein expression of MiT/TFE family members (MITF, TFEB, TFEC, and TFE3) in HUVECs in vitro. The in vitro findings were further confirmed using immunohistochemistry in a mouse model with a partially ligated carotid artery. Our results showed that LOSS down-regulated the expressions of TFEC and TFE3, while having no impact on MITF and TFEB expressions in HUVECs, the down-regulated expression of TFE3 were validated in the animal model. In conclusion, this study systematically explored the expression patterns of the MiT/TFE family in VECs under LOSS, providing new insights into the molecular mechanisms of abnormal hemodynamics-induced vascular endothelial inflammation-related diseases like atherosclerosis.

Atherosclerosis (AS) is a chronic inflammatory disease that affects large and medium arteries and is influenced by multiple factors [1]. The key initiating event and central theme throughout the entire pathological process of AS is endothelial inflammation [2,3]. Vascular Endothelial Cells (VECs), which form a monolayer lining the inner surface of blood vessels, play a crucial role. They not only detect changes in hemodynamic parameters but also convert mechanical force signals from blood flow into biological signals to regulate vascular homeostasis [4,5]. The frictional force between the pulsatile blood flow and VECs is referred to as Shear Stress (SS). The pattern and intensity of SS significantly impact the phenotype and function of VECs, influencing cell alignment [6,7], proliferation, migration [8], permeability [9,10], and inflammation [11,12]. Specifically, unidirectional Laminar Shear Stress (LSS) within the physiological range demonstrates endothelial protective effects and possesses anti-inflammatory and anti-atherosclerotic properties. On the contrary, low or turbulent (vortex or oscillatory flow) SS leads to endothelial damage, promoting inflammation and AS [13]. Despite this understanding, the precise pathological molecular mechanisms through which Low Oscillating Shear Stress (LOSS) damages the vascular endothelium are still largely unknown.

The MiT/TFE family of transcription factors is characterized by a common structure known as the basic helix-loop-helix leucine zipper (bHLH-Zip) [14]. Within vertebrates, this family comprises four closely related members: MITF, TFEB, TFE3, and TFEC. Initially identified as oncogenes, these factors are now recognized as crucial regulators of autophagy and lysosomal biogenesis [15]. In response to physiological conditions or stress, cells maintain metabolism and homeostasis by transporting redundant proteins or damaged organelles to lysosomes for degradation through a process called autophagy (macroautophagy) [16]. Several studies have indicated that autophagy plays a significant role in regulating the function of VECs and affects the occurrence and progression of AS [17,18]. It has been observed that LSS can suppress inflammation in human aortic endothelial cells by activating autophagy [12]. Moreover, sufficient endothelial autophagy under high shear stress conditions counteracts AS by preventing endothelial apoptosis and inflammation [19]. On the other hand, defective autophagy in regions of low shear stress contributes to the preferential formation of plaques in these areas, whereas increased autophagy levels under high shear stress reduce endothelial inflammation and apoptosis and promote endothelial alignment in the direction of flow [20]. In a recent study, it was demonstrated that LSS enhances both the mRNA and protein expression of TFEB in Human Umbilical Vein Endothelial Cells (HUVECs) and that TFEB exhibits anti-inflammatory properties in endothelial cells [21]. However, comprehensive investigations on whether endothelial-damaging Low Shear Stress (LOSS) affects the expression of MiT/TFE family transcription factors in VECs are lacking.

In this study, we employed a straightforward and practical shaker system to replicate oscillating blood flow in vitro and applied it to VECs. Subsequently, we systematically investigated the expression patterns of MiT/TFE family transcription factors at both the nucleic acid and protein levels. Furthermore, we validated the findings from the in vitro experiments using a mouse model. The primary objective of this research is to enhance our comprehension of the association between abnormal blood flow shear stress and vascular endothelial inflammation. By doing so, we aspire to establish a solid experimental groundwork for potential therapeutic approaches targeting vascular endothelial inflammation-related conditions, including AS.

Cell lines and cell culture

HUVECs cell lines were obtained from Procell Life Science & Technology Co., Ltd. (Wuhan, China) and cultured in Dulbecco’s Modified Eagle Medium (Gibco, NY, USA) containing 10% fetal bovine serum (Gibco, Australia origin) and 100 U/mL penicillin/0.1% streptomycin (Beyotime, Nantong, China) in a humidified 5% CO2 incubator at 37°C. For the following tests, cells were grown to the third passage.

Shear stress system

A simple rocking "see-saw" system (SK-R1807-S, DLAB Scientific, Beijing, China) was used to simulate LOSS in vitro, with shear forces ranging from approximately ± 4 dyn/cm2, as described in previous studies [22,23] Briefly, HUVECs were seeded in 6-well plates at a density of 2×104 cells per well. When the cell confluence rate is about 90%, place the 6-well plate on a rocker shaker with a frequency of 60 oscillations per minute and continue to culture in the incubator for a specified period of time.

qPCR analysis

Total RNA was extracted from the cells using the SteadyPure Universal RNA Extraction Kit after which the Evo M-MLV RT Mix Kit was used to prepare cDNA. qPCR was performed using the SYBR® Green Premix Pro Taq HS qPCR Kit according to the manufacturer’s protocol. The kits mentioned above were purchased from Accurate Biotechnology Co., Ltd (Hunan, China). Relative mRNA expression was calculated using the 2−ΔΔCt method, with β-actin serving as a normalization control. The primers used in the experiment were synthesized and provided by Tsingke Biotechnology Co., Ltd. (Beijing, China), and the primer sequences are shown in table 1.

Table 1: The sequences of the primers.
Name Sequence
ACTB F: CATGTACGTTGCTATCCAGGC
R: CTCCTTAATGTCACGCACGAT
KLF2 F: GTAACCATGACCACCAACCATTG
R: GGAAGTGAGGCCAGGCTATTTA
MITF F: GCTTACGCTTAACTCCAACTGTG
R: GGATCCATCAAGCCCAAGATTTC
TFEB F: AGGAGACGAAGGTTCAACATCAA
R: GAGCTGCTTGTTGGTCATCTCC
TFEC F: GAACAACAGAGAGCCCGAGAATT
R: ACCATGAGTACGAGCCTGAATTT
TFE3 F: GGAACGGCAGAAGAAAGACAATC
R: TCACTGGACTTAGGGATGAGAGT
Western blotting

Total proteins were extracted using RIPA lysis buffer (Beyotime, Nantong, China) on the ice and centrifuged at 12,000 rpm for 15 min at 4°C, according to the manufacturer’s instructions. A BCA kit (Beyotime, Nantong, China) was used to quantify protein concentrations. Samples were then boiled, and 20 µg protein from each sample were separated using sodium dodecyl-sulfate polyacrylamide gel electrophoresis (EpiZyme, Shanghai, China) and electrophoretically transferred to a polyvinylidene fluoride membrane. After blocking with 5% non-fat milk for 1h at room temperature, the membranes were incubated with primary antibodies targeting Krüppel-like Factor 2 (KLF2) (1:1000, Wanleibio, #WL05429), TNF-a (1:1000, Proteintech, "#26405-1-AP"), TFEB (1:5000, Proteintech, #13372-1-AP), TFE3 (1:1000, Proteintech, #14480-1-AP) and Anti-β-Actin (1:5000, Bioss, #bs-0061R) at 4°C overnight. The membranes were washed three times, followed by incubation with a secondary antibody (1:5000, Boster, #BA1054) at room temperature for 2 h, and a high-sensitivity electrochemiluminescence detection kit was used to detect protein bands using a chemiluminescence imaging system (Bio-Rad, CA, USA). Densitometric analyses of the protein bands were conducted using ImageJ software.

Experimental animals and Partial Ligation of Carotid Arteries

The animal experiment protocol in this study was approved by the Ethics Committee of the First Affiliated Hospital of Chongqing Medical University. C57BL/6J mice were purchased from the Animal Experiment Center of Chongqing Medical University. They were raised in an SPF-level animal room with a constant temperature of 24°C and a humidity of 40%-70%. The light cycle was a circadian rhythm of 12h/12h, and they had free access to food and water. Partial ligation of the Left Carotid Artery (PLA) was performed at 6-8 weeks of age, as described in a previous study [24]. Briefly, three of the four branches of the left carotid artery (external carotid, internal carotid, and occipital) were bluntly dissected under anesthesia and ligated with 6-0 silk sutures, while the superior thyroid artery was left intact. The right common carotid artery was only bluntly dissected as a sham operation.

Hematoxylin-eosin and immunohistochemical staining

Hematoxylin-eosin (HE) staining of vascular tissue was carried out according to the classical method. For Immunohistochemical (IHC) staining, vascular tissues were fixed with 4% paraformaldehyde, embedded in paraffin, and cut into serial 4 μm sections using a microtome. Sections were then blocked, stained with corresponding primary antibodies TNF-a (1:100, Proteintech, "#26405-1-AP"), TFE3 (1:100, Proteintech, #14480-1-AP), and imaged by microscopy. ImageJ processed the images and calculated the vascular lumen area and mean optical density for statistical data analysis.

Statistical analysis

SPSS 26.0 (IL, USA) and GraphPad Prism 8.0 (CA, USA) were used for statistical analyses. Data are presented as the mean ± Standard Deviation (SD) from at least three independent experiments. Statistical analyses were performed using t-tests to compare two groups or one-way analysis of variance to compare >2 groups. p < 0.05 was considered to be significantly different.

The mRNA expression pattern of MiT/TFE family in HUVECs under LOSS

We established the control group as the statically cultured HUVECs, while the experimental group consisted of HUVECs cultured using the rocker system to simulate LOSS. To assess the reliability of the fluid simulation produced by the rocker system, we focused on KLF2, a well-known fluid-sensitive transcription factor. We monitored the expression level of KLF2 to verify the accuracy of our simulated LOSS. As we increased the duration of LOSS loading, we observed a time-dependent decrease in the mRNA expression of KLF2 (Figure 1A), and the protein expression pattern of KLF2 followed a similar trend (Figure 1B). These results strongly support the reliability of the simulated LOSS conditions utilized in this study.

Additionally, we employed qPCR to investigate the expression of the MiT/TFE family (MITF, TFEB, TFEC, and TFE3) under the influence of LOSS. Compared to the static culture group, we found that the mRNA expression of MITF and TFEB remained unaffected by the prolonged treatment of LOSS. However, the mRNA expression of TFE3 and TFEC displayed a time-dependent decrease, with both significantly down regulated after 12 hours of LOSS treatment (Figure 1C).

LOSS induces protein expression of MiT/TFE family in HUVECs consistent with mRNA level

Based on the mRNA-level findings, our next objective was to validate the results at the protein level. Firstly, we observed that compared to the statically cultured group, the LOSS treatment led to a time-dependent increase in the protein expression of the inflammatory factor TNF-a in HUVECs (Figures 2A,B). Considering our earlier investigation of the expression of the MiT/TFE family at the mRNA level, which showed two categories: one with down-regulation (TFE3, TFEC) and the other with no significant change (MITF, TFEB). In addition, TFEB and TFE3 are key regulators of innate immunity and inflammation [25], and more importantly, TFEB has been shown to be closely associated with AS pathogenesis [26]. Therefore, we selected TFE3 and TFEB for WB validation. As anticipated, LOSS induced a time-dependent decrease in the protein expression of TFE3 in HUVECs (Figures 2A,D), while the protein level of TFEB remained unchanged (Figures 2A,C). These findings indicated that the expression patterns of the MiT/TFE family observed at the mRNA level were consistent with the protein-level results. The agreement between mRNA and protein level results strengthens the reliability of our findings and reinforces the involvement of the MiT/TFE family in the response to LOSS in HUVECs.

TFE3 expression is negatively correlated with LOSS-mediated arterial inflammation and inward remodeling

To further confirm the above results in vivo, we developed a mouse model in which the left carotid artery was partially ligated, creating a condition of low-oscillating blood flow in the Left Common Carotid Artery (LCCA). Bilateral carotid artery specimens were collected 20 weeks after the surgery. Histological examinations were performed using HE and IHC staining to assess intimal hyperplasia, lumen stenosis, and the expression of inflammatory factors and MiT/TFE transcription factors.

Through HE staining, we observed significant neointimal hyperplasia beneath the endothelial layer of the LCCA compared to the Right Common Carotid Artery (RCCA) at 20 weeks post-surgery (Figure 3A, marked by red two-way arrow). This condition was accompanied by a noticeable reduction in the luminal area of the vessel (Figure 3B). Additionally, we performed IHC staining for the inflammatory factor TNF-a and found that its expression in LCCA was significantly higher than that in RCCA (Figures 3C,D). Similarly, TFE3 staining revealed that the expression of TFE3 in LCCA was significantly lower than that in RCCA (Figures 3E,F). These findings in the animal vascular tissues are consistent with the expression pattern of TFE3 observed in HUVECs under low oscillatory shear stress (LOSS).

Although various comprehensive therapeutic approaches for AS are becoming more prevalent, such as smoking cessation, blood pressure and glucose management, cholesterol reduction, and endovascular therapies [27], atherosclerotic diseases like myocardial infarction and ischemic stroke continue to be the primary global causes of death. Therefore, there is an urgent necessity to delve deeper into the pathogenesis of AS to identify additional therapeutic targets.

Vascular endothelial cell dysfunction precedes the onset of atherosclerosis, Low Oscillatory Shear Stress (LOSS) is recognized as an important unfavorable hemodynamic factor that profoundly impairs the function of VECs, thereby affecting the development and progression of AS. Furthermore, increasing evidence suggests a close association between AS and dysfunction or defects in the autophagy-lysosomal pathway [18]. In this study, we initially systematically investigated the expression pattern of the MiT/TFE family of transcription factors (major regulators of autophagy and lysosomal biogenesis) in VECs in response to LOSS.

Firstly, we verified the reliability of the fluid model by examining the expression of the fluid-sensitive gene KLF2. As expected, under LOSS conditions, the expression of KLF2 showed a time-dependent decrease at both the mRNA and protein levels, while the inflammatory factor TNF-a showed enhanced expression, which is consistent with previous findings [24]. Next, we delved into the effect of LOSS on the expression of the MiT/TFE transcription factor family in HUVECs. Our results demonstrated that MiT/TFE factors exhibited distinct patterns of expression in response to LOSS. Specifically, the expression of MITF and TFEB was not significantly altered, while the expression of TFE3 and TFEC was notably down regulated. These findings were also reflected at the protein level for TFEB and TFE3, mirroring the changes observed at the mRNA level.

Previous studies have highlighted the close association between TFEB and various aspects of AS pathology, and the effects of TFEB on AS appear to vary depending on the specific vascular cells and pathogenic conditions [26]. For instance, TFEB overexpression in macrophages enhances lysosomal function and exerts an anti-atherosclerotic effect [28]. In an exogenous lipid environment, TFEB activation leads to increased lysosome formation and fusion of lipid droplets with lysosomes, effectively inhibiting the formation of foam cells derived from vascular smooth muscle cells [29]. However, it's worth noting that nicotine promotes TFEB nuclear translocation and upregulates cathepsin S expression, thereby promoting vascular smooth muscle cell migration and contributing to the progression of AS [30]. Moreover, TFEB has been found to reduce AS by inhibiting vascular endothelial cell inflammation through the upregulation of antioxidant genes. Interestingly, a study also revealed that laminar flow increases TFEB abundance in primary human endothelial cells cultured in vitro [21]. It's intriguing to note that laminar flow and LOSS often have opposing effects on VECs, and yet, in this study, we did not observe any impact of LOSS on TFEB expression. This observation seems to suggest that the endothelial protective effect of LSS may, to some extent, depend on TFEB, while the endothelial pathogenicity of LOSS is not associated with TFEB.

Indeed, while there have been some studies on the involvement of TFEB in AS, there is limited research regarding the direct association of MITF, TFEC, and TFE3 with AS. In this study, we present, for the first time, the effect of LOSS on the expression of these homologs of TFEB. To validate the accuracy of our findings at the cellular level, we conducted experiments using a PLA animal model in which TFE3 was used as a validation subject since TFE3 is considered a key regulator of inflammation [25]. The results from the PLA animal model demonstrated that LOSS significantly induced neointimal hyperplasia and inward remodeling of the vasculature. Additionally, the levels of the vessel wall inflammatory factor TNF-a were markedly elevated, while the expression of TFE3 was down regulated, which aligns with the observations made in the LOSS cellular model. The findings from this study shed light on the potential role of TFE3 in the pathological molecular mechanisms underlying LOSS-mediated vascular endothelial inflammation. Further exploration of how TFE3 is intricately involved in these mechanisms will undoubtedly be of great interest and significance in future research.

In conclusion, our study systematically evaluated the effect of LOSS on the expression of the MiT/TFE family of transcription factors, important regulators of the autophagy-lysosomal system, in VECs. Our findings indicate that the downregulation of TFE3 and TFEC may play a significant role in LOSS-mediated vascular inflammation and inward remodeling. These results offer new insights into the pathogenesis of endothelial inflammatory diseases, including AS, that are influenced by abnormal fluid flow conditions.

Author contributions

Xuehu Wang: Conceptualization; Chunkai Wang and Wanli Yu: Methodology; Liwen Deng: Software; Huanhuan Li: Validation; Huanhuan Li and Xiangyi Zuo: Formal analysis; Xiangyi Zuo: Data Curation; Huanhuan Li and Chunkai Wang: Writing – Original Draft; Huanhuan Li and Xuehu Wang: Writing – Review & Editing; Xiangyi Zuo and Wanli Yu: Visualization; Xuehu Wang and Yu Zhao: Supervision; Huanhuan Li and Xuehu Wang: Project administration; Xuehu Wang: Funding acquisition. All authors have read and agreed to the published version of the manuscript.

Disclosure statement

The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

Funding

This research was funded by the National Natural Science Foundation of the People’s Republic of China [grant number 8177021049].

Data availability statement

The data supporting the findings of this study are available within the article.

  1. Jebari-Benslaiman S, Galicia-García U, Larrea-Sebal A, Olaetxea JR, Alloza I, Vandenbroeck K, et al. Pathophysiology of Atherosclerosis. Int J Mol Sci. 2022;23(6). Epub 2022/03/26. doi: 10.3390/ijms23063346. PubMed PMID: 35328769; PubMed Central PMCID: PMCPMC8954705.
  2. Xu S, Ilyas I, Little PJ, Li H, Kamato D, Zheng X, et al. Endothelial Dysfunction in Atherosclerotic Cardiovascular Diseases and Beyond: From Mechanism to Pharmacotherapies. Pharmacol Rev. 2021;73(3):924-67. Epub 2021/06/06. doi: 10.1124/pharmrev.120.000096. PubMed PMID: 34088867.
  3. Libby P. Inflammation during the life cycle of the atherosclerotic plaque. Cardiovasc Res. 2021;117(13):2525-36. Epub 2021/09/23. doi: 10.1093/cvr/cvab303. PubMed PMID: 34550337; PubMed Central PMCID: PMCPMC8783385.
  4. Davies PF. Flow-mediated endothelial mechanotransduction. Physiol Rev. 1995;75(3):519-60. Epub 1995/07/01. doi: 10.1152/physrev.1995.75.3.519. PubMed PMID: 7624393; PubMed Central PMCID: PMCPMC3053532.
  5. Baratchi S, Khoshmanesh K, Woodman OL, Potocnik S, Peter K, McIntyre P. Molecular Sensors of Blood Flow in Endothelial Cells. Trends Mol Med. 2017;23(9):850-68. Epub 2017/08/16. doi: 10.1016/j.molmed.2017.07.007. PubMed PMID: 28811171.
  6. Goldfinger LE, Tzima E, Stockton R, Kiosses WB, Kinbara K, Tkachenko E, et al. Localized alpha4 integrin phosphorylation directs shear stress-induced endothelial cell alignment. Circ Res. 2008;103(2):177-85. Epub 2008/06/28. doi: 10.1161/circresaha.108.176354. PubMed PMID: 18583710; PubMed Central PMCID: PMCPMC2669779.
  7. Sathanoori R, Bryl-Gorecka P, Müller CE, Erb L, Weisman GA, Olde B, et al. P2Y(2) receptor modulates shear stress-induced cell alignment and actin stress fibers in human umbilical vein endothelial cells. Cell Mol Life Sci. 2017;74(4):731-46. Epub 2016/09/22. doi: 10.1007/s00018-016-2365-0. PubMed PMID: 27652381; PubMed Central PMCID: PMCPMC5272905.
  8. Ando J, Nomura H, Kamiya A. The effect of fluid shear stress on the migration and proliferation of cultured endothelial cells. Microvasc Res. 1987;33(1):62-70. Epub 1987/01/01. doi: 10.1016/0026-2862(87)90007-0. PubMed PMID: 3561268.
  9. Akbari E, Spychalski GB, Rangharajan KK, Prakash S, Song JW. Flow dynamics control endothelial permeability in a microfluidic vessel bifurcation model. Lab Chip. 2018;18(7):1084-93. Epub 2018/03/01. doi: 10.1039/c8lc00130h. PubMed PMID: 29488533; PubMed Central PMCID: PMCPMC7337251.
  10. Wang G, Kostidis S, Tiemeier GL, Sol W, de Vries MR, Giera M, et al. Shear Stress Regulation of Endothelial Glycocalyx Structure Is Determined by Glucobiosynthesis. Arterioscler Thromb Vasc Biol. 2020;40(2):350-64. Epub 2019/12/13. doi: 10.1161/atvbaha.119.313399. PubMed PMID: 31826652.
  11. Chen PY, Qin L, Li G, Wang Z, Dahlman JE, Malagon-Lopez J, et al. Endothelial TGF-β signalling drives vascular inflammation and atherosclerosis. Nat Metab. 2019;1(9):912-26. Epub 2019/10/02. doi: 10.1038/s42255-019-0102-3. PubMed PMID: 31572976; PubMed Central PMCID: PMCPMC6767930.
  12. Meng Q, Pu L, Qi M, Li S, Sun B, Wang Y, et al. Laminar shear stress inhibits inflammation by activating autophagy in human aortic endothelial cells through HMGB1 nuclear translocation. Commun Biol. 2022;5(1):425. Epub 2022/05/07. doi: 10.1038/s42003-022-03392-y. PubMed PMID: 35523945; PubMed Central PMCID: PMCPMC9076621.
  13. Cheng H, Zhong W, Wang L, Zhang Q, Ma X, Wang Y, et al. Effects of shear stress on vascular endothelial functions in atherosclerosis and potential therapeutic approaches. Biomed Pharmacother. 2023;158:114198. Epub 2023/03/15. doi: 10.1016/j.biopha.2022.114198. PubMed PMID: 36916427.
  14. Carr CS, Sharp PA. A helix-loop-helix protein related to the immunoglobulin E box-binding proteins. Mol Cell Biol. 1990;10(8):4384-8. Epub 1990/08/01. doi: 10.1128/mcb.10.8.4384-4388.1990. PubMed PMID: 2115126; PubMed Central PMCID: PMCPMC360994.
  15. Di Malta C, Cinque L, Settembre C. Transcriptional Regulation of Autophagy: Mechanisms and Diseases. Front Cell Dev Biol. 2019;7:114. Epub 2019/07/18. doi: 10.3389/fcell.2019.00114. PubMed PMID: 31312633; PubMed Central PMCID: PMCPMC6614182.
  16. Yamamoto H, Zhang S, Mizushima N. Autophagy genes in biology and disease. Nat Rev Genet. 2023;24(6):382-400. Epub 2023/01/13. doi: 10.1038/s41576-022-00562-w. PubMed PMID: 36635405; PubMed Central PMCID: PMCPMC9838376.
  17. Lin L, Zhang MX, Zhang L, Zhang D, Li C, Li YL. Autophagy, Pyroptosis, and Ferroptosis: New Regulatory Mechanisms for Atherosclerosis. Front Cell Dev Biol. 2021;9:809955. Epub 2022/02/01. doi: 10.3389/fcell.2021.809955. PubMed PMID: 35096837; PubMed Central PMCID: PMCPMC8793783.
  18. Mameli E, Martello A, Caporali A. Autophagy at the interface of endothelial cell homeostasis and vascular disease. Febs j. 2022;289(11):2976-91. Epub 2021/05/03. doi: 10.1111/febs.15873. PubMed PMID: 33934518.
  19. Vion AC, Kheloufi M, Hammoutene A, Poisson J, Lasselin J, Devue C, et al. Autophagy is required for endothelial cell alignment and atheroprotection under physiological blood flow. Proc Natl Acad Sci U S A. 2017;114(41):E8675-e84. Epub 2017/10/05. doi: 10.1073/pnas.1702223114. PubMed PMID: 28973855; PubMed Central PMCID: PMCPMC5642679.
  20. Kheloufi M, Vion AC, Hammoutene A, Poisson J, Lasselin J, Devue C, et al. Endothelial autophagic flux hampers atherosclerotic lesion development. Autophagy. 2018;14(1):173-5. Epub 2017/11/22. doi: 10.1080/15548627.2017.1395114. PubMed PMID: 29157095; PubMed Central PMCID: PMCPMC5846556.
  21. Lu H, Fan Y, Qiao C, Liang W, Hu W, Zhu T, et al. TFEB inhibits endothelial cell inflammation and reduces atherosclerosis. Sci Signal. 2017;10(464). Epub 2017/02/02. doi: 10.1126/scisignal.aah4214. PubMed PMID: 28143903.
  22. Tucker RP, Henningsson P, Franklin SL, Chen D, Ventikos Y, Bomphrey RJ, et al. See-saw rocking: an in vitro model for mechanotransduction research. J R Soc Interface. 2014;11(97):20140330. Epub 2014/06/06. doi: 10.1098/rsif.2014.0330. PubMed PMID: 24898022; PubMed Central PMCID: PMCPMC4208364.
  23. Michael Delaine-Smith R, Javaheri B, Helen Edwards J, Vazquez M, Rumney RM. Preclinical models for in vitro mechanical loading of bone-derived cells. Bonekey Rep. 2015;4:728. Epub 2015/09/04. doi: 10.1038/bonekey.2015.97. PubMed PMID: 26331007; PubMed Central PMCID: PMCPMC4549923.
  24. Nam D, Ni CW, Rezvan A, Suo J, Budzyn K, Llanos A, et al. Partial carotid ligation is a model of acutely induced disturbed flow, leading to rapid endothelial dysfunction and atherosclerosis. Am J Physiol Heart Circ Physiol. 2009;297(4):H1535-43. Epub 2009/08/18. doi: 10.1152/ajpheart.00510.2009. PubMed PMID: 19684185; PubMed Central PMCID: PMCPMC2770764.
  25. Irazoqui JE. Key Roles of MiT Transcription Factors in Innate Immunity and Inflammation. Trends Immunol. 2020;41(2):157-71. Epub 2020/01/22. doi: 10.1016/j.it.2019.12.003. PubMed PMID: 31959514; PubMed Central PMCID: PMCPMC6995440.
  26. Lu H, Sun J, Hamblin MH, Chen YE, Fan Y. Transcription factor EB regulates cardiovascular homeostasis. EBioMedicine. 2021;63:103207. Epub 2021/01/09. doi: 10.1016/j.ebiom.2020.103207. PubMed PMID: 33418500; PubMed Central PMCID: PMCPMC7804971.
  27. Engelen SE, Robinson AJB, Zurke YX, Monaco C. Therapeutic strategies targeting inflammation and immunity in atherosclerosis: how to proceed? Nat Rev Cardiol. 2022;19(8):522-42. Epub 2022/02/02. doi: 10.1038/s41569-021-00668-4. PubMed PMID: 35102320; PubMed Central PMCID: PMCPMC8802279.
  28. Sergin I, Evans TD, Zhang X, Bhattacharya S, Stokes CJ, Song E, et al. Exploiting macrophage autophagy-lysosomal biogenesis as a therapy for atherosclerosis. Nat Commun. 2017;8:15750. Epub 2017/06/08. doi: 10.1038/ncomms15750. PubMed PMID: 28589926; PubMed Central PMCID: PMCPMC5467270.
  29. Pi H, Wang Z, Liu M, Deng P, Yu Z, Zhou Z, et al. SCD1 activation impedes foam cell formation by inducing lipophagy in oxLDL-treated human vascular smooth muscle cells. J Cell Mol Med. 2019;23(8):5259-69. Epub 2019/05/24. doi: 10.1111/jcmm.14401. PubMed PMID: 31119852; PubMed Central PMCID: PMCPMC6652860.
  30. Ni H, Xu S, Chen H, Dai Q. Nicotine Modulates CTSS (Cathepsin S) Synthesis and Secretion Through Regulating the Autophagy-Lysosomal Machinery in Atherosclerosis. Arterioscler Thromb Vasc Biol. 2020;40(9):2054-69. Epub 2020/07/10. doi: 10.1161/atvbaha.120.314053. PubMed PMID: 32640907.

✨ Call for Preprints Submissions

Are you the author of a recent Preprint? We invite you to submit your manuscript for peer-reviewed publication in our open access journal.
Benefit from fast review, global visibility, and exclusive APC discounts.

Submit Now   Archive
?